ID: 1019431645_1019431663

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1019431645 1019431663
Species Human (GRCh38) Human (GRCh38)
Location 7:1002271-1002293 7:1002323-1002345
Sequence CCCTGTGGGTGAGTGGAATCCTG CTGTGGGTGTGGAGCCCTGTGGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 3, 3: 12, 4: 137} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!