ID: 1019431652_1019431666

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1019431652 1019431666
Species Human (GRCh38) Human (GRCh38)
Location 7:1002290-1002312 7:1002328-1002350
Sequence CCTGTGGGTGGGGAGTCCTGTGG GGTGTGGAGCCCTGTGGGTGGGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 15, 3: 77, 4: 514}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!