ID: 1019431657_1019431671

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1019431657 1019431671
Species Human (GRCh38) Human (GRCh38)
Location 7:1002306-1002328 7:1002346-1002368
Sequence CCTGTGGGTAGGGAATCCTGTGG TGGGGAGTCCTGTGGGTGAATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 39, 3: 32, 4: 147} {0: 1, 1: 35, 2: 9, 3: 60, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!