ID: 1019434955_1019434966

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1019434955 1019434966
Species Human (GRCh38) Human (GRCh38)
Location 7:1017799-1017821 7:1017814-1017836
Sequence CCCGCCCCCCACTGCACACAAGG ACACAAGGCCAGGCGCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 540} {0: 1, 1: 0, 2: 2, 3: 16, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!