ID: 1019443137_1019443144

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1019443137 1019443144
Species Human (GRCh38) Human (GRCh38)
Location 7:1057416-1057438 7:1057429-1057451
Sequence CCCTGTACCTGCAGCACTTCTGG GCACTTCTGGGCCAGGGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 227} {0: 1, 1: 0, 2: 1, 3: 46, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!