ID: 1019474253_1019474265

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1019474253 1019474265
Species Human (GRCh38) Human (GRCh38)
Location 7:1236442-1236464 7:1236486-1236508
Sequence CCGCCGCCGCGGGGCTGGACTTC CCGCGGACCCTGATCGGCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 162} {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!