ID: 1019475522_1019475534

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1019475522 1019475534
Species Human (GRCh38) Human (GRCh38)
Location 7:1242375-1242397 7:1242403-1242425
Sequence CCGCCCCGGCCGAGACGCTGGGC CCCCACAGGCTGCGCCTGACGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!