ID: 1019477914_1019477923

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1019477914 1019477923
Species Human (GRCh38) Human (GRCh38)
Location 7:1252838-1252860 7:1252874-1252896
Sequence CCTAGGCGGGCTTCCTCAGGGCC GGGGGCCACCGATCATTCAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!