ID: 1019496797_1019496803

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1019496797 1019496803
Species Human (GRCh38) Human (GRCh38)
Location 7:1344529-1344551 7:1344582-1344604
Sequence CCAACATTGGGGATTACAATTTT AACCATATCAGGCAGCTGCCAGG
Strand - +
Off-target summary {0: 2, 1: 157, 2: 989, 3: 2533, 4: 3736} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!