ID: 1019509564_1019509572

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1019509564 1019509572
Species Human (GRCh38) Human (GRCh38)
Location 7:1411014-1411036 7:1411057-1411079
Sequence CCATTGTGGGGAGCACAGAGCGT CTCCTAGAGCAGATGGAGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!