ID: 1019517231_1019517236

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1019517231 1019517236
Species Human (GRCh38) Human (GRCh38)
Location 7:1445396-1445418 7:1445413-1445435
Sequence CCCGAGTGCAGCGTGCAGGAGCA GGAGCACTGCTTACACCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 134} {0: 1, 1: 0, 2: 4, 3: 92, 4: 997}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!