ID: 1019519103_1019519114

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1019519103 1019519114
Species Human (GRCh38) Human (GRCh38)
Location 7:1452660-1452682 7:1452708-1452730
Sequence CCATCTCACCCCCAGACCCACAG TCAGAGCACCCCAGGCCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 52, 4: 642} {0: 1, 1: 0, 2: 1, 3: 29, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!