ID: 1019526987_1019526990

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1019526987 1019526990
Species Human (GRCh38) Human (GRCh38)
Location 7:1484920-1484942 7:1484940-1484962
Sequence CCCAGGGCAGGGTCTCTGTGCTG CTGACCCCGTCCCCTCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 64, 4: 518} {0: 1, 1: 3, 2: 3, 3: 53, 4: 506}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!