ID: 1019534859_1019534866

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1019534859 1019534866
Species Human (GRCh38) Human (GRCh38)
Location 7:1523615-1523637 7:1523628-1523650
Sequence CCACGCTGAACTTCCCGAGCTCG CCCGAGCTCGGGGTGGGATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!