ID: 1019538730_1019538733

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1019538730 1019538733
Species Human (GRCh38) Human (GRCh38)
Location 7:1541912-1541934 7:1541927-1541949
Sequence CCTGCAAGGTGGTGCCTGGGGCC CTGGGGCCCTGGCTCCTTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 279} {0: 1, 1: 0, 2: 3, 3: 48, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!