ID: 1019539730_1019539737

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1019539730 1019539737
Species Human (GRCh38) Human (GRCh38)
Location 7:1546266-1546288 7:1546287-1546309
Sequence CCCACAGCCCCACGGTGCTGGCC CCAGCCTCACAGGTGCCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 268} {0: 1, 1: 0, 2: 2, 3: 30, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!