ID: 1019540328_1019540337

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1019540328 1019540337
Species Human (GRCh38) Human (GRCh38)
Location 7:1548330-1548352 7:1548361-1548383
Sequence CCCCCGTGCTGGCGGGACCTCTC CATGCCCGCAGGTTCTACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119} {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!