ID: 1019545039_1019545050

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1019545039 1019545050
Species Human (GRCh38) Human (GRCh38)
Location 7:1570074-1570096 7:1570105-1570127
Sequence CCGTCCACCTTCCGGAAGTCAGG GCTTCTGGTCCCGGAGACTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 156} {0: 1, 1: 0, 2: 2, 3: 24, 4: 625}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!