ID: 1019564407_1019564417

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1019564407 1019564417
Species Human (GRCh38) Human (GRCh38)
Location 7:1672265-1672287 7:1672318-1672340
Sequence CCACCATGCCCCAGGACTGCCAC GGAGGCAGGCTCCCCACACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 34, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!