ID: 1019574379_1019574384

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1019574379 1019574384
Species Human (GRCh38) Human (GRCh38)
Location 7:1729326-1729348 7:1729343-1729365
Sequence CCAGCTTCTTTTGCTCAGGGTTC GGGTTCTTGGGTCAGGCACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 22, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!