ID: 1019575621_1019575636

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1019575621 1019575636
Species Human (GRCh38) Human (GRCh38)
Location 7:1736288-1736310 7:1736341-1736363
Sequence CCCTCCGCCCACCTTTCCCCCTG CCTCAGTCCAGCCCCGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 101, 4: 1255} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!