ID: 1019577479_1019577487

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1019577479 1019577487
Species Human (GRCh38) Human (GRCh38)
Location 7:1744479-1744501 7:1744504-1744526
Sequence CCCTGAGAGTGCAGGCACCTCCC TCCCGCCCCTCCATCCCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 221} {0: 1, 1: 0, 2: 2, 3: 24, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!