ID: 1019588281_1019588292

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1019588281 1019588292
Species Human (GRCh38) Human (GRCh38)
Location 7:1816306-1816328 7:1816331-1816353
Sequence CCCCTCCAGCCATGGGGGCTTCC CAGTCTGAGGACCTGGACAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 36, 4: 311} {0: 2, 1: 0, 2: 4, 3: 27, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!