ID: 1019588468_1019588474

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1019588468 1019588474
Species Human (GRCh38) Human (GRCh38)
Location 7:1817035-1817057 7:1817083-1817105
Sequence CCAATTAAACAAGGGGCCCTTGA ACGGCCAATGAGCTCATGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 81} {0: 1, 1: 1, 2: 0, 3: 6, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!