ID: 1019594901_1019594907

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1019594901 1019594907
Species Human (GRCh38) Human (GRCh38)
Location 7:1853977-1853999 7:1853993-1854015
Sequence CCGCCAGCTCCCGGCGCCATTCT CCATTCTCATGCCGTGCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 209} {0: 1, 1: 0, 2: 1, 3: 8, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!