ID: 1019603275_1019603280

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1019603275 1019603280
Species Human (GRCh38) Human (GRCh38)
Location 7:1895870-1895892 7:1895884-1895906
Sequence CCTGCCACTGGAAAGAAGGGACA GAAGGGACAGCAAGGGCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 221} {0: 1, 1: 0, 2: 6, 3: 66, 4: 646}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!