ID: 1019603275_1019603291

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1019603275 1019603291
Species Human (GRCh38) Human (GRCh38)
Location 7:1895870-1895892 7:1895913-1895935
Sequence CCTGCCACTGGAAAGAAGGGACA AGTGAGGGGGCGGCCTGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 221} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!