ID: 1019610689_1019610702

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1019610689 1019610702
Species Human (GRCh38) Human (GRCh38)
Location 7:1935312-1935334 7:1935363-1935385
Sequence CCGGGAGCAGCCCTTGTGCAGGT CATCAGCTCGCCCCTCAATCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!