ID: 1019610798_1019610808

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1019610798 1019610808
Species Human (GRCh38) Human (GRCh38)
Location 7:1935806-1935828 7:1935829-1935851
Sequence CCAGGCCCCACCACAGATGAGCC TGCAGACACCCCCAAGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 272} {0: 1, 1: 0, 2: 1, 3: 31, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!