ID: 1019613980_1019613985

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1019613980 1019613985
Species Human (GRCh38) Human (GRCh38)
Location 7:1950625-1950647 7:1950653-1950675
Sequence CCTCAATGTCTGCCCCCAGCTGC TCACCTCCTCCCCTGCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 363} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!