ID: 1019628969_1019628974

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1019628969 1019628974
Species Human (GRCh38) Human (GRCh38)
Location 7:2036342-2036364 7:2036361-2036383
Sequence CCCAGGCATGAGCGCAGGAGCGC GCGCTGACAAGTCAGGACAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!