ID: 1019628969_1019628977

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1019628969 1019628977
Species Human (GRCh38) Human (GRCh38)
Location 7:2036342-2036364 7:2036395-2036417
Sequence CCCAGGCATGAGCGCAGGAGCGC TTCCTGCGCCACCTCCGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 19, 3: 81, 4: 3577} {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!