ID: 1019645668_1019645683

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1019645668 1019645683
Species Human (GRCh38) Human (GRCh38)
Location 7:2127533-2127555 7:2127584-2127606
Sequence CCAAGGTCCAGACGTCAGGAACC AACGACCTGGGGTCTAGGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!