ID: 1019659433_1019659437

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1019659433 1019659437
Species Human (GRCh38) Human (GRCh38)
Location 7:2215767-2215789 7:2215782-2215804
Sequence CCATCACAGCAACCTCCATGTTG CCATGTTGTAGGTGAGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 271} {0: 1, 1: 0, 2: 3, 3: 20, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!