ID: 1019659435_1019659442

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1019659435 1019659442
Species Human (GRCh38) Human (GRCh38)
Location 7:2215779-2215801 7:2215815-2215837
Sequence CCTCCATGTTGTAGGTGAGCAGC CACAATACCGAGGCTCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 168} {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!