ID: 1019659436_1019659446

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1019659436 1019659446
Species Human (GRCh38) Human (GRCh38)
Location 7:2215782-2215804 7:2215826-2215848
Sequence CCATGTTGTAGGTGAGCAGCTGG GGCTCCTCCAGGCAGGGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 191} {0: 1, 1: 0, 2: 6, 3: 60, 4: 515}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!