ID: 1019668791_1019668798

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1019668791 1019668798
Species Human (GRCh38) Human (GRCh38)
Location 7:2267094-2267116 7:2267125-2267147
Sequence CCTCCCTGAGCCTGTTTCTCCAT CAGGCCTCCCAGCCCTGTGTCGG
Strand - +
Off-target summary {0: 2, 1: 8, 2: 34, 3: 203, 4: 779} {0: 1, 1: 1, 2: 1, 3: 37, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!