ID: 1019668791_1019668805

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1019668791 1019668805
Species Human (GRCh38) Human (GRCh38)
Location 7:2267094-2267116 7:2267142-2267164
Sequence CCTCCCTGAGCCTGTTTCTCCAT TGTCGGAGCAACTGAAACGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 7, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!