ID: 1019693493_1019693508

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1019693493 1019693508
Species Human (GRCh38) Human (GRCh38)
Location 7:2431529-2431551 7:2431581-2431603
Sequence CCTTCCACCTTGTGGATGCCAGG CACACTGACAGTACCCTGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 12, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!