ID: 1019709465_1019709483

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1019709465 1019709483
Species Human (GRCh38) Human (GRCh38)
Location 7:2511681-2511703 7:2511719-2511741
Sequence CCCAGCCCCAGCCTTGTCTTCAG CCACCTGGAGGCTGTGGGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 16, 3: 107, 4: 673}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!