ID: 1019720220_1019720231

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1019720220 1019720231
Species Human (GRCh38) Human (GRCh38)
Location 7:2565331-2565353 7:2565374-2565396
Sequence CCGGTCCTGACTGCGTTTCACCT CAGGCTGGAGGCAGCACGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 61, 4: 1581}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!