ID: 1019723225_1019723243

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1019723225 1019723243
Species Human (GRCh38) Human (GRCh38)
Location 7:2586360-2586382 7:2586412-2586434
Sequence CCAAGACACAGGGTACCTTCCTG TGGCAGGGAATGGCAGGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 185} {0: 1, 1: 1, 2: 38, 3: 507, 4: 2347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!