ID: 1019731552_1019731566

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1019731552 1019731566
Species Human (GRCh38) Human (GRCh38)
Location 7:2632081-2632103 7:2632118-2632140
Sequence CCTGAAGCCCGCGCCCCGGGCCA CGCAGGCCGCGCGCATCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 207} {0: 1, 1: 0, 2: 1, 3: 3, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!