ID: 1019734082_1019734094

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1019734082 1019734094
Species Human (GRCh38) Human (GRCh38)
Location 7:2641891-2641913 7:2641930-2641952
Sequence CCCTGACACCCAGGCTCTGCATG GGGACCCGGGCAGCCCAAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!