ID: 1019742168_1019742180

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1019742168 1019742180
Species Human (GRCh38) Human (GRCh38)
Location 7:2680393-2680415 7:2680440-2680462
Sequence CCCGGGAGACCCCGGATCCTGCA GCCCAGACATGCAGCCGCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 9, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!