ID: 1019742174_1019742180

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1019742174 1019742180
Species Human (GRCh38) Human (GRCh38)
Location 7:2680404-2680426 7:2680440-2680462
Sequence CCGGATCCTGCAGGGCTTCTCCA GCCCAGACATGCAGCCGCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 9, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!