ID: 1019744064_1019744073

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1019744064 1019744073
Species Human (GRCh38) Human (GRCh38)
Location 7:2689655-2689677 7:2689701-2689723
Sequence CCTGAAACACCGCAGTGGCACCT GACGCAGGCATGAGACCTGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!