ID: 1019745930_1019745938

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1019745930 1019745938
Species Human (GRCh38) Human (GRCh38)
Location 7:2700390-2700412 7:2700409-2700431
Sequence CCCGGGTGGCCCATGGACAGCAG GCAGCAGGGGCTCCCAGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 244} {0: 1, 1: 0, 2: 10, 3: 65, 4: 546}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!