|
Left Crispr |
Right Crispr |
| Crispr ID |
1019747965 |
1019747974 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:2711128-2711150
|
7:2711149-2711171
|
| Sequence |
CCGTTCCGTGAGCACCATCTCCT |
CTGAGGCTGTGGAGGGAAGAGGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 1, 1: 2, 2: 19, 3: 193, 4: 1599} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|