ID: 1019778553_1019778563

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1019778553 1019778563
Species Human (GRCh38) Human (GRCh38)
Location 7:2926532-2926554 7:2926577-2926599
Sequence CCCCATTACCTACAAGACAAAGA AGCCATGGGCAAGCCCAATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 284} {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!